Reseñas rápidas: “Pink Venom” es definitivamente una de las canciones de BLACKPINK de todos los tiempos

Resenas rapidas Pink Venom es definitivamente una de las canciones

BLACKPINK regresó con su primer sencillo en aproximadamente dos años, un prelanzamiento de su próximo Nacido rosa álbum llamado “veneno rosa“. Si bien esperaba una evolución, esperaba mucho de lo mismo y, de hecho, obtuvimos una de las canciones de BLACKPINK que jamás existieron.

El entusiasmo por este o cualquier lanzamiento de BLACKPINK obviamente está fuera de serie, y ayudó que “Pink Venom” comience con una combinación de sonidos tradicionales (un geomungo, creo) y elementos modernos, que durante mucho tiempo ha sido mi elección de producción favorita. . Sin embargo, al igual que con la mayoría de las canciones de BLACKPINK, el factor determinante es básicamente qué tan pegadizo es el gancho, y la repetición de “this that pink venom”/”sabor that pink venom” simplemente no es efectiva. A diferencia de sus ganchos llenos de onomatopeyas, incluso los chorros del coro de TikTok no deberían poder engañar a las personas para que la canción sea atractiva. Hay mucha fanfarronada (gratatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatata) y el video musical se veía increíble cuando no lo era T-ara salta cortando por todas partes, pero no hay una tonelada a la que agarrarse por todas partes.

Como dije antes de su lanzamiento en las redes sociales, esperaba que fuera algo mortal, ya que significaría que muchas personas aquí tendrían que arreglárselas, desafortunadamente esto no será así.

Deja una respuesta

Tu dirección de correo electrónico no será publicada. Los campos obligatorios están marcados con *

Información básica sobre protección de datos Ver más

  • Responsable:
  • Finalidad:  Moderar los comentarios.
  • Legitimación:  Por consentimiento del interesado.
  • Destinatarios y encargados de tratamiento:  No se ceden o comunican datos a terceros para prestar este servicio. El Titular ha contratado los servicios de alojamiento web a Banahosting que actúa como encargado de tratamiento.
  • Derechos: Acceder, rectificar y suprimir los datos.
  • Información Adicional: Puede consultar la información detallada en la Política de Privacidad.

Publicar un comentario

Esta web utiliza cookies propias y de terceros para su correcto funcionamiento y para fines analíticos y para fines de afiliación y para mostrarte publicidad relacionada con sus preferencias en base a un perfil elaborado a partir de tus hábitos de navegación. Al hacer clic en el botón Aceptar, acepta el uso de estas tecnologías y el procesamiento de tus datos para estos propósitos. Ver Política de cookies